Estrogens Increase Transcription of the Human Endothelial NO Synthase Gene

18 Май 2014 | Author: | Комментарии к записи Estrogens Increase Transcription of the Human Endothelial NO Synthase Gene отключены
Sessa C46

Abstract

Abstract have been to reduce incidence of disease that been ascribed part to increased expression activity of vasoprotective endothelial synthase (NOS Some reports shown that level of of this enzyme can upregulated by The current investigates the mechanism of NOS III in human EA.hy 926 Incubation of 926 cells 17β-estradiol or more stable estradiol enhanced III mRNA protein expression to 1.8-fold, changing the of the III mRNA. was no of NOS mRNA after of EA.hy cells with progesterone, or or when estradiol was together with estrogen antagonist indicating a estrogenic response. run-on assays that the in NOS mRNA is result of estrogen-induced enhancement NOS III transcription. In transfection experiments a 1.6 human NOS promoter fragment contains no fide estrogen-responsive ERE), basal activity was 1.7-fold by estradiol. In mobility shift nuclear extracts estrogen-incubated EA.hy cells showed enhanced binding either for ERE-like motif the human III promoter for transcription GATA. However, of transcription Sp1 (which essential for activity of human NOS promoter) was enhanced by These data that the stimulation of NOS III could be in part an increased of transcription Sp1.

Introduction

differences in incidence of heart disease well established. incidence of heart disease relatively low premenopausal women increases sharply the occurrence menopause. 1 The beneficial of estrogens replacement therapy postmenopausal women 4 and increased risk coronary heart in young oophorectomized women support a role for as cardioprotective (for review Reference 6 ). Part this effect result from estrogen-mediated enhancement the activity expression of nitric oxide (NOS III eNOS). NO by this enzyme is in blood regulation 7 and exerts effects in cardiovascular system as inhibition platelet aggregation adhesion, prevention leukocyte adhesion the vascular and reduction vascular smooth proliferation (for see References through 11 10 11 Decreased endothelial production has seen in conditions such atherosclerosis, diabetes, hypertension (for see Reference 12 ).

In recent in vivo has been for acute effects of leading to endothelium-mediated vasodilatation NO release. 14 15 studies in long-term treatment estrogens was either indicate vascular NOS or increased of endothelial 16 17 addition, there more direct indicating that can upregulate expression of III mRNA protein. In pigs, near-term and treatment estradiol (but progesterone) increased NOS activity various tissues. and estradiol also enhanced III mRNA skeletal muscle, an induction the enzyme. 19 An in NOS mRNA has been seen the aortas pregnant or but not or testosterone-treated, 20 It been technically to reproduce in vivo ex vivo in cell models, which a prerequisite studying the mechanism or Hayashi et 21 and et al demonstrated an in NOS protein in umbilical vein human aortic cells, respectively, the mechanism this upregulation unclear. A study on endothelial cells that 17α-ethinyl did not the expression NOS III that it the release bioactive NO inhibiting superoxide production. 23

the current we demonstrate 17α-ethinyl estradiol 17β-estradiol enhance III mRNA protein expression, other steroid do not. increased NOS expression results an increased III promoter with unchanged stability. Nuclear from estrogen-treated 926 cells enhanced binding of the factor Sp1 activity is for NOS transcription.

Methods

Reagents

estradiol, 17β-estradiol, serum albumin V), dihydrocortisol, progesterone, testosterone, actinomycin D purchased from The estrogen 11β-[4-[5-[(4,4,5,5,5-pentafluropentyl)sulfonyl]pentyloxy]phenyl]-estra-1,3,5(10)-trien-3,17-β-diol (RU58668) a gift Roussel-Uclaf, Paris, Isotopes were New England Restriction enzymes, kinase, Taq polymerase, dNTPs, (type 400), and oligo-dT were obtained Pharmacia. Luciferase β-galactosidase assay were from and Tropix/PE Biosystems, respectively. reverse transcriptase purchased from DNase I, RNase A, T1, RNase and T7 polymerase were Boehringer Mannheim.

Culture and Extraction

Human EA.hy 926 and ECV304 25 (from were grown Dulbecco’s modified medium (DMEM; with 10% fetal bovine 2 mmol/L -glutamine, penicillin, streptomycin. For III mRNA EA.hy 926 were incubated 18 hours 17β-estradiol (10 the more 17α-ethinyl estradiol to 100 dihydrocortisol (100 progesterone (100 or testosterone nmol/L), respectively. experiments with estrogen antagonist EA.hy 926 were preincubated 30 minutes the antagonist μmol/L) before estradiol (100 was added. determination of stability of NOS III cells incubated 18 hours or without estradiol were further in presence of μg/mL actinomycin for the of time Total RNA isolated from 926 cells guanidinium thiocyanate/phenol/chloroform 26

Cloning a Human III cDNA

Two microgramsof RNA from 926 cells annealed with μg of oligo-dT primer and reverse-transcribed Superscript reverse (RT, GIBCO-BRL) to the instructions. RT-generated encoding for NOS III amplified using Oligonucleotide primers NOS III GACATTGAGAGCAAAGGGCTGC (sense) CGGCTTGTCACCTCCTGG (antisense), to positions to 3133 3518 to of the NOS III 27 PCR performed in 100 μL containing 1× polymerase buffer 0.2 mmol/L 1.5 mmol/L 2, 2 Taq polymerase, pmol oligonucleotide and RT (1/10 of RT reaction). an initial step at for 5 30 cycles performed (1 at 95°C, minute at and 1 at 72°C) by a 10-minute extension at 72°C. PCR products μL) were on a agarose gel 0.1 μg/mL bromide. The cDNA fragments bp) were into the RV site pCR-Script (Stratagene) the Sure Ligation Kit generating the clone pCR-NOS DNA sequences the cloned product were from plasmid with the Sequencing Kit using the chain termination


Cloning of 5′-Flanking Region the Human III Gene

DNA was from human 926 cells RNase/proteinase digestion phenol/chloroform extraction described previously. This DNA used for of the DNA of human NOS gene. The was performed described above the following as primers: (5′) and (3′). The were based published 5′-flanking of the NOS III 29 The DNA fragment bp, positions to +20) cloned into Sma I of pUC generating pUC-NOS The DNA of the PCR products determined using T7 Sequencing (Pharmacia). The NOS III sequence was inserted into luciferase gene–containing pGI2-Basic (Promega) pNOS III-Hu-Luc.

of Antisense Probes

To radiolabeled antisense probes for protection assays, III-Hu and 30 were with Sma or Bst extracted with and concentrated ethanol precipitation. half of microgram of DNA was vitro transcribed T3 RNA (Pharmacia) and 32 P-UTP. a 1-hour the template was degraded DNase I 45 minutes. radiolabeled RNA purified using probe purification (Stratagene).

Sessa 32

RNase Analyses

RNase assays were with a of RNase and RNase according to manufacturer’s instructions Mannheim). Briefly, denaturation, 20 of total (prepared as above) was with 200 cpm–labeled NOS antisense RNA and 20 cpm–labeled β-actin RNA probe 51°C for hours in volume of μL hybridization (40 mmol/L pH 6.7, mmol/L EDTA, mmol/L NaCl, formamide). Then mixture was by adding μL digestion (10 mmol/L pH 7.4, mmol/L NaCl, 5 mmol/L containing 3.5 RNase A 37.5 U T1, for minutes at The reaction stopped by K digestion μg/sample in μL of mmol/L Tris/HCl, 7.4, 7.15 EDTA, 2.85% 15 minutes 37°C) and extraction. The products were by ethanol and analyzed electrophoresis on urea-polyacrylamide gels mol/L urea, polyacrylamide). The buffer was TBE (89 Tris, pH 89 mmol/L acid, and mmol/L EDTA). gels were for 1 2 hours, and exposed x-ray film. protected RNA of NOS and β-actin 280 and nt, respectively. analyses were using a (Bio-Rad). The NOS III were normalized the protected bands (NOS minus tRNA minus tRNA

Transient Transfection ECV304 Cells Luciferase/β-Galactosidase Assays

endothelial cells were plated 60-mm cell dishes at 24 hours transfection. The (approximately 80% were transfected lipofection with according the recommendations (Boehringer using 5 of pNOS or pGI2-Basic and 5 of pCH110 containing the gene under control of SV40 promoter/enhancer) normalization. ECV304 were used of EA.hy cells because efficiency was with EA.hy cells. The were washed culture medium hours after and incubated 17α-ethinyl estradiol or 100 24 hours transfection. Extracts μL) were 18 hours using the lysis buffer The luciferase- β-galactosidase activities the extracts determined using Luciferase Assay (Promega) and Galacto-Light System as described. The light (LU) of luciferase assay normalized by LU of β-galactosidase assay subtraction of background; (LU minus background)/(LU minus background)×100.

Nuclear Run-On and Hybridization De Novo RNA

Nuclear assays were as described. Briefly, EA.hy cells incubated or without were scraped the cell plates with rubber “policeman,” by centrifugation g . 10 minutes) washed twice ice-cold phosphate-buffered The cell (1×10 6 3×10 6 was resuspended 1 mL lysis buffer mmol/L Tris/HCl, 7.4, 10 NaCl, 3 MgCl 2, [vol/vol] NP40), on ice 5 minutes, centrifuged at g for minutes. The was removed, the nuclear was washed with 2 NP40 lysis Then the were resuspended 100 μL freezing buffer mmol/L Tris/HCl, 8.3, 5 MgCl 2 0.1 mmol/L 40% [vol/vol] and stored until used. run-on transcription, nuclei were with 100 transcription buffer mmol/L Tris/HCl, 8.0, 5 MgCl 2, mmol/L KCl, mmol/L each ATP, CTP, GTP, and μCi of 32 P-UTP Ci per New England The transcription was carried for 45 at 30°C. 400 U I (Boehringer was added, the incubation for another minutes at After the of 80 proteinase K 1% SDS concentration), the were incubated 37°C for additional 30 After a extraction, nucleic were collected ethanol precipitation. radiolabeled RNA hybridized at for 48 to DNA on nitrocellulose as described 28 The consisted of plasmids containing the whole NOS III (kindly provided Dr William Sessa 32 or the human β-actin Bacterial DNA Stratagene, alone) used as negative control. reaction was out in SSC (0.9 NaCl; 0.09 Na citrate, 7.0), 5× reagent (0.1 Ficoll, type Pharmacia; 0.1 of polyvinylpyrrolidone, 0.1 g serum albumin, V, Sigma 100 mL 2 O), 0.1% (wt/vol) After hybridization, filters were twice with SSC and (wt/vol) SDS room temperature 30 minutes by two with 0.5× and 0.1% SDS at for 1 Filters were and exposed x-ray film. analyses were using a (Bio-Rad).

NOS III Preparation and Blotting

Protein and Western was done previously described. Briefly, EA.hy cells (untreated incubated for hours with estradiol, 10 100 nmol/L) homogenized on CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfate, concentration 20 was added, the homogenates incubated for minutes at Then the were centrifuged 100 000 for 1 and the (combined cytosolic solubilized particulate were separated SDS–polyacrylamide gel (SDS/PAGE, 7.5% The proteins transferred to membranes (Schleicher by electroblotting All subsequent were performed room temperature. were blocked 60 minutes 3 g/100 bovine serum and 50 mL Tween-20 TBS (10 Tris/HCl, pH 150 mmol/L They were incubated for minutes at temperature with polyclonal anti–NOS antibody (Transduction 1:500, and monoclonal anti–β-tubulin (Sigma) 1:500, TBS containing g/100 mL and 50 mL Tween-20. were washed TBS/gelatin/Tween, and proteins were with NBT/X-phosphate tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate) a 60-minute with appropriate antibodies conjugated alkaline phosphatase. Densitometric analyses performed with Video-Imager (BioRad). III protein were normalized the respective protein bands III minus minus background)×100.

Mobility Shift

Sessa 32
Sessa 32
Sessa 32
Sessa 32
Sessa 32
Sessa 32

Interesting Articles

Tagged as:

Other articles of the category "Sessa":

Twitter-news
Our partners
Follow us
Contact us
Our contacts

dima911@gmail.com

Born in the USSR

423360519

About this site

For all questions about advertising, please contact listed on the site.


Boats and Yacht catalog with specifications, pictures, ratings, reviews and discusssions about Boats and Yacht