Estrogens Increase Transcription of the Human Endothelial NO Synthase Gene

18 мая 2014 | Author: | No comments yet »
Sessa C46

Abstract

Abstract —Estrogens have been found to reduce the incidence of cardiovascular disease that has been ascribed in part to an increased expression and/or activity of the vasoprotective endothelial NO synthase (NOS III). Some reports have shown that the level of expression of this constitutive enzyme can be upregulated by estrogens. The current study investigates the molecular mechanism of the NOS III upregulation in human endothelial EA.hy 926 cells. Incubation of EA.hy 926 cells with 17β-estradiol or the more stable 17α-ethinyl estradiol enhanced NOS III mRNA and protein expression up to 1.8-fold, without changing the stability of the NOS III mRNA. There was no enhancement of NOS III mRNA after incubation of EA.hy 926 cells with testosterone, progesterone, or dihydrocortisol or when 17α-ethinyl estradiol was added together with the estrogen antagonist RU58668, indicating a specific estrogenic response. Nuclear run-on assays indicated that the increase in NOS III mRNA is the result of an estrogen-induced enhancement of NOS III gene transcription. In transient transfection experiments using a 1.6 kb human NOS III promoter fragment (which contains no bona fide estrogen-responsive element, ERE), basal promoter activity was enhanced 1.7-fold by 17α-ethinyl estradiol. In electrophoretic mobility shift assays, nuclear extracts from estrogen-incubated EA.hy 926 cells showed no enhanced binding activity either for the ERE-like motif in the human NOS III promoter or for transcription factor GATA. However, binding of transcription factor Sp1 (which is essential for the activity of the human NOS III promoter) was significantly enhanced by estrogens. These data suggest that the estrogen stimulation of the NOS III promoter could be mediated in part by an increased activity of transcription factor Sp1.

Introduction

Sex differences in the incidence of coronary heart disease are well established. The incidence of coronary heart disease is relatively low among premenopausal women and increases sharply with the occurrence of menopause. 1 2 The beneficial effect of estrogens in replacement therapy of postmenopausal women 3 4 and the increased risk of coronary heart disease in young bilateral oophorectomized women 5 support a fundamental role for estrogens as cardioprotective agents (for review see Reference 6 6 ). Part of this effect may result from an estrogen-mediated enhancement of the activity and/or expression of endothelial nitric oxide synthase (NOS III or eNOS). NO generated by this endothelial enzyme is involved in blood pressure regulation 7 8 and exerts protective effects in the cardiovascular system such as inhibition of platelet aggregation and adhesion, prevention of leukocyte adhesion to the vascular wall, and reduction of vascular smooth muscle proliferation (for review see References 9 through 11 9 10 11 ). Decreased endothelial NO production has been seen in pathophysiological conditions such as atherosclerosis, diabetes, and hypertension (for review see Reference 12 12 ).

In recent years, in vivo evidence has been presented for acute vascular effects of estrogens leading to improved endothelium-mediated vasodilatation and/or NO release. 13 14 15 Other studies in which long-term treatment with estrogens was used either indicate improved vascular NOS activity or increased expression of endothelial NOS. 16 17 In addition, there is more direct evidence indicating that estrogens can upregulate the expression of NOS III mRNA and protein. In guinea pigs, near-term pregnancy and treatment with estradiol (but not progesterone) increased calcium-dependent NOS activity in various tissues. Pregnancy and estradiol both also enhanced NOS III mRNA in skeletal muscle, suggesting an induction of the enzyme. 18 19 An increase in NOS III mRNA has also been seen in the aortas of pregnant or estrogen-treated, but not progesterone- or testosterone-treated, rats. 20 It has been technically difficult to reproduce these in vivo or ex vivo findings in cell culture models, which is a prerequisite for studying the molecular mechanism or mechanisms. Hayashi et al 21 and Hishikawa et al 22 demonstrated an increase in NOS III protein in human umbilical vein and human aortic endothelial cells, respectively, but the mechanism of this upregulation remained unclear. A recent study on bovine endothelial cells claimed that 17α-ethinyl estradiol did not enhance the expression of NOS III but that it increased the release of bioactive NO by inhibiting superoxide anion production. 23

In the current study we demonstrate that 17α-ethinyl estradiol and 17β-estradiol enhance NOS III mRNA and protein expression, whereas other steroid hormones do not. The increased NOS III expression results from an increased NOS III promoter activity with unchanged mRNA stability. Nuclear extracts from estrogen-treated EA.hy 926 cells display enhanced binding activity of the transcription factor Sp1 whose activity is essential for NOS III transcription.

Methods

Reagents

17α-ethinyl estradiol, 17β-estradiol, bovine serum albumin (fraction V), dihydrocortisol, polyvinylpyrrolidone, progesterone, testosterone, and actinomycin D were purchased from Sigma. The estrogen antagonist 11β-[4-[5-[(4,4,5,5,5-pentafluropentyl)sulfonyl]pentyloxy]phenyl]-estra-1,3,5(10)-trien-3,17-β-diol (RU58668) was a gift from Roussel-Uclaf, Paris, France. Isotopes were from New England Nuclear/DuPont. Restriction enzymes, polynucleotide kinase, Taq DNA polymerase, dNTPs, Ficoll (type 400), oligonucleotides, and oligo-dT primers were obtained from Pharmacia. Luciferase and β-galactosidase assay systems were from Promega and Tropix/PE Applied Biosystems, respectively. Superscript reverse transcriptase was purchased from GIBCO/BRL. DNase I, DOTAP, RNase A, RNase T1, RNase T3, and T7 RNA polymerase were from Boehringer Mannheim.

Cell Culture and RNA Extraction

Human endothelial EA.hy 926 24 and ECV304 cells 25 (from ATCC) were grown in Dulbecco’s modified Eagle’s medium (DMEM; GIBCO) with 10% charcoal-stripped fetal bovine serum, 2 mmol/L l -glutamine, penicillin, and streptomycin. For NOS III mRNA analyses, EA.hy 926 cells were incubated for 18 hours with 17β-estradiol (10 nmol/L), the more stable 17α-ethinyl estradiol (0.1 to 100 nmol/L), dihydrocortisol (100 nmol/L), progesterone (100 nmol/L), or testosterone (100 nmol/L), respectively. In experiments with the estrogen antagonist RU58668, EA.hy 926 cells were preincubated for 30 minutes with the antagonist (1 μmol/L) before 17α-ethinyl estradiol (100 nmol/L) was added. For determination of the stability of the NOS III mRNA, cells incubated for 18 hours with or without 17α-ethinyl estradiol were incubated further in the presence of 10 μg/mL actinomycin D for the periods of time indicated. Total RNA was isolated from EA.hy 926 cells by guanidinium thiocyanate/phenol/chloroform extraction. 26

Cloning of a Human NOS III cDNA Fragment

Two microgramsof total RNA from EA.hy 926 cells was annealed with 0.5 μg of an oligo-dT primer (Pharmacia) and reverse-transcribed with Superscript reverse transcriptase (RT, GIBCO-BRL) according to the manufacturer’s instructions. RT-generated cDNAs encoding for human NOS III were amplified using PCR. Oligonucleotide primers for NOS III were GACATTGAGAGCAAAGGGCTGC (sense) and CGGCTTGTCACCTCCTGG (antisense), corresponding to positions 3111 to 3133 and 3518 to 3536 of the human NOS III cDNA. 27 PCR was performed in a 100 μL volume containing 1× Taq polymerase buffer (Pharmacia), 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl 2, 2 U Taq polymerase, 50 pmol oligonucleotide primers and RT products (1/10 of the RT reaction). After an initial denaturation step at 95°C for 5 minutes, 30 cycles were performed (1 minute at 95°C, 1 minute at 60°C, and 1 minute at 72°C) followed by a final 10-minute extension step at 72°C. The PCR products (30 μL) were analyzed on a 1.5% agarose gel containing 0.1 μg/mL ethidium bromide. The amplified cDNA fragments (426 bp) were cloned into the Eco RV site of pCR-Script (Stratagene) using the Sure Clone Ligation Kit (Pharmacia), generating the cDNA clone pCR-NOS III-Hu. DNA sequences of the cloned PCR product were determined from plasmid templates with the T7 Sequencing Kit (Pharmacia) using the dideoxy chain termination method.


Cloning of the 5′-Flanking Region From the Human NOS III Gene

Chromosomal DNA was isolated from human EA.hy 926 cells by RNase/proteinase digestion and phenol/chloroform extraction as described previously. 28 This DNA was used for amplification of the 5′-flanking DNA of the human NOS III gene. The PCR was performed as described above using the following oligonucleotides as primers: TGATGCTGCCTGTCACCTTG (5′) and TACTGTGCGTCCACTCTGCTGC (3′). The sequences were based on published 5′-flanking sequences of the human NOS III gene. 29 The amplified DNA fragment (1616 bp, positions −1596 to +20) was cloned into the Sma I site of pUC 18, generating pUC-NOS III-Hu-5′. The DNA sequence of the cloned PCR products was determined using the T7 Sequencing Kit (Pharmacia). The human NOS III 5′-flanking sequence was then inserted into the luciferase gene–containing plasmid pGI2-Basic (Promega) generating pNOS III-Hu-Luc.

Preparation of Antisense RNA Probes

To generate radiolabeled antisense RNA probes for RNase protection assays, pCR-NOS III-Hu and pCR-β-actin-Hu 30 were linearized with Sma I or Bst EII, extracted with phenol/chloroform, and concentrated by ethanol precipitation. One half of a microgram of this DNA was in vitro transcribed using T3 RNA polymerase (Pharmacia) and α- 32 P-UTP. After a 1-hour incubation, the template DNA was degraded with DNase I for 45 minutes. The radiolabeled RNA was purified using NucTrap probe purification columns (Stratagene).

Sessa 32

RNase Protection Analyses

RNase protection assays were performed with a mixture of RNase A and RNase T1 according to the manufacturer’s instructions (Boehringer Mannheim). Briefly, following denaturation, 20 μg of total RNA (prepared as described above) was hybridized with 200 000 cpm–labeled NOS III antisense RNA probe and 20 000 cpm–labeled β-actin antisense RNA probe at 51°C for 16 hours in a volume of 40 μL hybridization buffer (40 mmol/L PIPES, pH 6.7, 1 mmol/L EDTA, 400 mmol/L NaCl, 50% formamide). Then the mixture was digested by adding 300 μL digestion buffer (10 mmol/L Tris/HCl, pH 7.4, 300 mmol/L NaCl, and 5 mmol/L EDTA) containing 3.5 μg RNase A and 37.5 U RNase T1, for 30 minutes at 30°C. The reaction was stopped by proteinase K digestion (70 μg/sample in 70 μL of 7.15 mmol/L Tris/HCl, pH 7.4, 7.15 mmol/L EDTA, 2.85% SDS; 15 minutes at 37°C) and phenol extraction. The reaction products were concentrated by ethanol precipitation and analyzed by electrophoresis on denaturing urea-polyacrylamide gels (8 mol/L urea, 6% polyacrylamide). The electrophoresis buffer was 1× TBE (89 mmol/L Tris, pH 8.3, 89 mmol/L boric acid, and 20 mmol/L EDTA). The gels were electrophoresed for 1 to 2 hours, dried, and exposed to x-ray film. The protected RNA fragments of NOS III and β-actin were 280 and 108 nt, respectively. Densitometric analyses were performed using a Phospho-Imager (Bio-Rad). The protected NOS III bands were normalized using the protected β-actin bands (NOS III minus tRNA background)/(β-actin minus tRNA background)×100.

Transient Transfection of ECV304 Cells and Luciferase/β-Galactosidase Assays

ECV304 endothelial cells 25 were plated in 60-mm cell culture dishes at least 24 hours before transfection. The cells (approximately 80% confluent) were transfected by lipofection with DOTAP according the manufacturer’s recommendations (Boehringer Mannheim) using 5 μg of pNOS III-Hu-Luc or pGI2-Basic (Promega), and 5 μg of pCH110 (Pharmacia; containing the β-galactosidase gene under the control of the SV40 promoter/enhancer) for normalization. ECV304 cells were used instead of EA.hy 926 cells because transfection efficiency was poor with EA.hy 926 cells. The cells were washed with culture medium 9 hours after transfection and incubated with 17α-ethinyl estradiol (10 or 100 nmol/L) 24 hours after transfection. Extracts (400 μL) were prepared 18 hours later using the reporter lysis buffer (Promega). The luciferase- and β-galactosidase activities of the extracts were determined using the Luciferase Assay System (Promega) and the Galacto-Light System (Tropix) as described. 30 The light units (LU) of the luciferase assay were normalized by the LU of the β-galactosidase assay after subtraction of extract background; (LU Luc minus background)/(LU β-Gal minus background)×100.

Nuclear Run-On Assay and Hybridization of De Novo Radiolabeled RNA

Nuclear run-on assays were performed as described. 31 Briefly, EA.hy 926 cells incubated with or without estrogens were scraped from the cell culture plates with a rubber “policeman,” collected by centrifugation (500 g . 4°C, 10 minutes) and washed twice with ice-cold phosphate-buffered saline. The cell pellet (1×10 6 to 3×10 6 cells) was resuspended in 1 mL NP40 lysis buffer (10 mmol/L Tris/HCl, pH 7.4, 10 mmol/L NaCl, 3 mmol/L MgCl 2, 0.5% [vol/vol] NP40), incubated on ice for 5 minutes, and centrifuged at 500 g for 5 minutes. The supernatant was removed, and the nuclear pellet was washed twice with 2 mL NP40 lysis buffer. Then the nuclei were resuspended in 100 μL nuclei freezing buffer (50 mmol/L Tris/HCl, pH 8.3, 5 mmol/L MgCl 2 . 0.1 mmol/L EDTA, 40% [vol/vol] glycerol) and stored frozen until used. For run-on transcription, the nuclei were mixed with 100 μL transcription buffer (10 mmol/L Tris/HCl, pH 8.0, 5 mmol/L MgCl 2, 300 mmol/L KCl, 0.5 mmol/L each of ATP, CTP, and GTP, and 80 μCi of α- 32 P-UTP (800 Ci per mmol, New England Nuclear). The transcription reaction was carried out for 45 minutes at 30°C. Then, 400 U DNase I (Boehringer Mannheim) was added, and the incubation continued for another 15 minutes at 30°C. After the addition of 80 μg proteinase K and 1% SDS (final concentration), the samples were incubated at 37°C for an additional 30 minutes. After a phenol/chloroform extraction, nucleic acids were collected by ethanol precipitation. The radiolabeled RNA was hybridized at 65°C for 48 hours to DNA immobilized on nitrocellulose filters as described previously. 28 The DNA consisted of linearized plasmids containing either the whole bovine NOS III cDNA (kindly provided by Dr William C. Sessa 32 ) or the whole human β-actin cDNA. Bacterial DNA (pCR-Script, Stratagene, alone) was used as a negative control. The reaction was carried out in 6× SSC (0.9 mol/L NaCl; 0.09 mol/L Na citrate, pH 7.0), 5× Denhardt’s reagent (0.1 g Ficoll, type 500, Pharmacia; 0.1 g of polyvinylpyrrolidone, Sigma; 0.1 g bovine serum albumin, Fraction V, Sigma in 100 mL H 2 O), and 0.1% (wt/vol) SDS. After hybridization, the filters were washed twice with 2× SSC and 0.1% (wt/vol) SDS at room temperature for 30 minutes followed by two washes with 0.5× SSC and 0.1% (wt/vol) SDS at 65°C for 1 hour. Filters were air-dried and exposed to x-ray film. Densitometric analyses were performed using a Phospho-Imager (Bio-Rad).

NOS III Protein Preparation and Western Blotting

Protein isolation and Western blotting was done as previously described. 33 Briefly, EA.hy 926 cells (untreated and incubated for 36 hours with 17α-ethinyl estradiol, 10 or 100 nmol/L) were homogenized on ice. CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfate, final concentration 20 mmol/L) was added, and the homogenates were incubated for 30 minutes at 4°C. Then the homogenates were centrifuged at 100 000 g for 1 hour, and the supernatants (combined cytosolic and solubilized particulate fraction) were separated by SDS–polyacrylamide gel electrophoresis (SDS/PAGE, 7.5% gels). The proteins were transferred to nitrocellulose membranes (Schleicher Schuell) by electroblotting (Bio-Rad). All subsequent steps were performed at room temperature. Blots were blocked for 60 minutes with 3 g/100 mL bovine serum albumin and 50 mg/100 mL Tween-20 in TBS (10 mmol/L Tris/HCl, pH 7.4; 150 mmol/L NaCl). They were then incubated for 90 minutes at room temperature with a polyclonal anti–NOS III antibody (Transduction Laboratories) 1:500, and a monoclonal anti–β-tubulin antibody (Sigma) 1:500, in TBS containing 0.5 g/100 mL gelatin and 50 mg/100 mL Tween-20. Blots were washed in TBS/gelatin/Tween, and immunoreactive proteins were visualized with NBT/X-phosphate (4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate) after a 60-minute incubation with appropriate secondary antibodies conjugated to alkaline phosphatase. 33 Densitometric analyses were performed with a Video-Imager (BioRad). NOS III protein bands were normalized using the respective β-tubulin protein bands (NOS III minus background)/(β-tubulin minus background)×100.

Electrophoretic Mobility Shift Assay

Sessa 32
Sessa 32
Sessa 32
Sessa 32
Sessa 32
Sessa 32

Interesting Articles

Tagged as:

Here you can write a commentary on the recording "Estrogens Increase Transcription of the Human Endothelial NO Synthase Gene".

* Required fields
All the reviews are moderated.
Twitter-news
Our partners
Follow us
Contact us
Our contacts

dima911@gmail.com

Born in the USSR

423360519

About this site

For all questions about advertising, please contact listed on the site.


Boats and Yacht catalog with specifications, pictures, ratings, reviews and discusssions about Boats and Yacht